Detection of Four Mismatched Nucleotides between DENV4 Specific C-prM Primer (rTS4) and Current DENV 4 Sequences in Sabah
DOI:
https://doi.org/10.51200/bjms.v13i2.1696Keywords:
Dengue 4 C-prM primersAbstract
Dear Sir/ Madam,
Dengue is the mosquito borne viral disease caused by dengue virus serotype 1 to 4 (DENV 1 to 4).
Dengue outbreaks are common in both east and west Malaysia. Between July 2016 and December 2017, 200 serum samples positive for dengue by rapid test were collected from patients in Sandakan and Kudat of Sabah state during dengue outbreaks. Serotypes of the dengue viruses were determined by reverse transcriptase polymerase chain reaction (RT-PCR) followed by nested PCR. We used C-prM primers designed by Lanciotti et al1 and later redesigned by Chien et al2. We detected all the four dengue serotypes with PCR products with specific sizes in gel electrophoresis. However, in four samples, no serotype-specific band was amplified by the nested PCR, while they were dengue-positive in RT-PCR showing 511 bp amplicon. We first presumed that these DENV might belong to a new DENV serotype, accordingly nucleotide sequences of the 511 bp amplicons of the four samples were determined. As a result, all the four samples (K35, K81, S23 and K75) (K and S stands for Kudat and Sandakan respectively) were found to belong to DENV4. We aligned the sequences of these samples with that of DENV 4 reverse primer (rTS4) (Fig.1).
The DENV4 specific primer rTS4 was found to have four mismatched nucleotides to the current DENV4 sequences. Therefore, for the local DENV4 in Sabah, we recommend a modified rTS4 reverse primer TTCTCCTATTCAAGATGTTT (or CTTCTCCTATTCAAGATGTTTAAC) (red nucleotides are modified ones) to be included in the dengue C-prM primers in future research.
Downloads
Published
How to Cite
Issue
Section
License
Borneo Journal of Medical Sciences
Copyright transfer and contributions agreement to publish in Borneo Journal of Medical Sciences (BJMS)
Transfer our author right to Borneo Journal of Medical Sciences (BJMS Publishers) along with title, interest in article without any limitations. The Journal shall own the work, including 1) copyright; 2) the right to grant permission to republish the article in whole or in part, with or without fee; 3) the right to produce preprints or reprints and translate into languages other than English for sale or free distribution; and 4) the right for electronic/visual reproduction, electronic storage and to republish the work in a collection of articles in any other mechanical or electronic format or printed publications.
We, the authors certify to participate sufficiently in the intellectual content, conception and design of this work or the analysis and interpretation of the data (when applicable), as well as the writing of the manuscript, to take public responsibility for it and have agreed to have our name listed as a contributor. We believe the manuscript represents valid work. Neither this manuscript nor one with substantially similar content under our authorship has been published or is being considered for publication elsewhere, except as described in the covering letter. Any such involvement, publishers of BJMS are not responsible and the authors are held for any untoward practices if any. Any other reproduction of the said article requires the permission from the publisher.
Authors also state that, the work is original and is not infringing with the rights of others and copyrights. Author also further declares that, each co-author have contributed significantly and have accepted to be co-authors for their significant contribution for the work.
We certify that all the data collected during the study is presented in this manuscript and no data from the study has been or will be published separately. We attest that, if requested by the editors, we will provide the data/information or will cooperate fully in obtaining and providing the data/information on which the manuscript is based, for examination by the editors or their assignees.
We give the rights to the corresponding author to make necessary changes as per the request of the journal, do the rest of the correspondence on our behalf and he/she will act as the guarantor for the manuscript on our behalf. All persons who have made substantial contributions to the work reported in the manuscript, but who are not contributors, are named in the Acknowledgment and have given us their written permission to be named. If we do not include an Acknowledgment that means we have not received substantial contributions from non-contributors and no contributor has been omitted.
![](/ojums/public/site/icon-view.png)
![](/ojums/public/site/icon-download.png)