Detection of Four Mismatched Nucleotides between DENV4 Specific C-prM Primer (rTS4) and Current DENV 4 Sequences in Sabah

Authors

  • Tin Sabai Aung Faculty of Medicine and Health Sciences, Department of Pathobiology and Medical Diagnostics
  • Amalina Emran Department of Pathobiology and Medical Diagnostics, FPSK, UMS
  • Tin Tin Thein Department of Pathobiology and Medical Diagnostics, FPSK, UMS
  • Timothy Jr Gintarong Department of Pathobiology and Medical Diagnostics, FPSK, UMS
  • Nobumichi Kobayashi Department of Hygiene, Sapporo Medical University School of Medicine, Sapporo, Japan

DOI:

https://doi.org/10.51200/bjms.v13i2.1696

Keywords:

Dengue 4 C-prM primers

Abstract

Dear Sir/ Madam,

Dengue is the mosquito borne viral disease caused by dengue virus serotype 1 to 4 (DENV 1 to 4).

Dengue outbreaks are common in both east and west Malaysia. Between July 2016 and December 2017, 200 serum samples positive for dengue by rapid test were collected from patients in Sandakan and Kudat of Sabah state during dengue outbreaks. Serotypes of the dengue viruses were determined by reverse transcriptase polymerase chain reaction (RT-PCR) followed by nested PCR. We used C-prM primers designed by Lanciotti et al1 and later redesigned by Chien et al2. We detected all the four dengue serotypes with PCR products with specific sizes in gel electrophoresis. However, in four samples, no serotype-specific band was amplified by the nested PCR, while they were dengue-positive in RT-PCR showing 511 bp amplicon. We first presumed that these DENV might belong to a new DENV serotype, accordingly nucleotide sequences of the 511 bp amplicons of the four samples were determined. As a result, all the four samples (K35, K81, S23 and K75) (K and S stands for Kudat and Sandakan respectively) were found to belong to DENV4. We aligned the sequences of these samples with that of DENV 4 reverse primer (rTS4) (Fig.1).

The DENV4 specific primer  rTS4 was found to have four mismatched nucleotides to the current DENV4 sequences. Therefore, for the local DENV4 in Sabah, we recommend a modified  rTS4 reverse primer TTCTCCTATTCAAGATGTTT (or CTTCTCCTATTCAAGATGTTTAAC) (red nucleotides are modified ones) to be included in the dengue C-prM primers in future research.

Author Biography

Tin Sabai Aung, Faculty of Medicine and Health Sciences, Department of Pathobiology and Medical Diagnostics

Associate Professor

Department of Pathobiology and Medical Diagnostics.

Downloads

Published

2019-05-28

How to Cite

Aung, T. S., Emran, A., Thein, T. T., Gintarong, T. J., & Kobayashi, N. (2019). Detection of Four Mismatched Nucleotides between DENV4 Specific C-prM Primer (rTS4) and Current DENV 4 Sequences in Sabah. Borneo Journal of Medical Sciences (BJMS), 13(2), 61. https://doi.org/10.51200/bjms.v13i2.1696
Total Views: 335 | Total Downloads: 266

Most read articles by the same author(s)